Wikidata:Database reports/Constraint violations/P3329
Jump to navigation
Jump to search
Constraint violations report for CIViC variant ID (Discussion, uses, items, changes, related properties): identifier used in the CIViC database to identify specific variant
Data time stamp: (UTC) — Items processed: 2,012
The report is generated based on the settings on Property:P3329#P2302.
Updates overwrite this page. Some may already be fixed since the last update: check RecentChangesLinked.
When incremental dumps and the bot work as planned, items fixed before 07:00 UTC disappear in the next update. The report is not updated if only the item count changes.
The report can include false positives. There is no need to "fix" them.
Data time stamp: (UTC) — Items processed: 2,012
The report is generated based on the settings on Property:P3329#P2302.
Updates overwrite this page. Some may already be fixed since the last update: check RecentChangesLinked.
When incremental dumps and the bot work as planned, items fixed before 07:00 UTC disappear in the next update. The report is not updated if only the item count changes.
The report can include false positives. There is no need to "fix" them.
"Format" violations
[edit]Violations count: 0
"Item instance of (P31)" violations
[edit]Violations count: 310
- TP53 R306X (Q29938372)
- TP53 R282W (Q29938373)
- TP53 C275Y (Q29938376)
- TP53 V272M (Q29938380)
- TP53 R248L (Q29938381)
- TP53 R248FS (Q29938383)
- TP53 R213X (Q29938386)
- TP53 V272L (Q29938529)
- TP53 G245D (Q29938530)
- TP53 R342X (Q29938531)
- TP53 E298X (Q29938533)
- TP53 E286V (Q29938534)
- TP53 E285K (Q29938535)
- TP53 D281E (Q29938536)
- TP53 D281G (Q29938537)
- TP53 D281H (Q29938539)
- TP53 R280S (Q29938541)
- TP53 R280I (Q29938543)
- TP53 C275G (Q29938546)
- TP53 R273G (Q29938547)
- TP53 F270S (Q29938548)
- TP53 R267P (Q29938552)
- TP53 G266R (Q29938553)
- TP53 D259Y (Q29938554)
- TP53 I255S (Q29938556)
- TP53 T253P (Q29938557)
- TP53 G245V (Q29938559)
- TP53 G244S (Q29938563)
- TP53 M243V (Q29938564)
- TP53 C242S (Q29938566)
- TP53 S241C (Q29938569)
- TP53 Y234S (Q29938575)
- TP53 V216L (Q29938576)
- TP53 V203L (Q29938583)
- TP53 L201F (Q29938585)
- TP53 R196X (Q29938589)
- TP53 I195N (Q29938592)
- TP53 L194P (Q29938593)
- TP53 H193R (Q29938594)
- TP53 P190L (Q29938596)
- TP53 H179Q (Q29938598)
- TP53 H179R (Q29938600)
- TP53 H179Y (Q29938601)
- TP53 H179D (Q29938602)
- TP53 R174W (Q29938606)
- TP53 V173L (Q29938607)
- TP53 Y163C (Q29938608)
- TP53 M160K (Q29938611)
- TP53 R158P (Q29938617)
- TP53 P151H (Q29938622)
- TP53 C141W (Q29938623)
- TP53 K132R (Q29938626)
- TP53 K132T (Q29938628)
- TP53 K132E (Q29938630)
- TP53 K132Q (Q29938631)
- TP53 L130V (Q29938632)
- TP53 Y103X (Q29938635)
- TP53 V73L (Q29938638)
- TP53 D42Y (Q29938640)
- VHL Q132P (c.395A>C) (Q42786636)
- VHL F91* (c.272_273delinsAA) (Q42786647)
- VHL V170G (c.509T>C) (Q42786663)
- VHL Exon 3 Deletion (Q42786682)
- VHL T105fs (c.315insAC) (Q42786690)
- VHL P71fs (c.211insT) (Q42786691)
- VHL L140fs (c.417_418delTC) (Q42786697)
- VHL M54fs (c.161insT) (Q42786699)
- VHL Splicing alteration (c.463+2C>T) (Q42786721)
- VHL P61fs (c.183insC) (Q42786738)
- VHL R108ins (c.324InsCGC) (Q42786745)
- VHL A149fs (c.449del14-nt) (Q42786748)
- VHL Null (Partial deletion of Exons 2 & 3) (Q42786760)
- VHL T152fs (c.455insA) (Q42786785)
- VHL G114dup (c.342dupGGT) (Q42786806)
- VHL Q73fs (c.214insGCCC) (Q42786810)
- VHL C77fs (c.228dup) (Q42786813)
- VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT) (Q42786816)
- VHL H125fs (c.374insA) (Q42786818)
- VHL T202fs (c.606insA) (Q42786827)
- RAD50 L1237F (Q44844631)
- ERRFI1 E384Ter (Q44844639)
- EGFR V834I (Q44847119)
- ACVR1 Gain-of-Function (Q44847200)
- VHL P40fs (c.118ins) (Q50092790)
- VHL T157fs (c.472ins) (Q50092792)
- BARD1 LOSS-OF-FUNCTION (Q50092860)
- ALK ALK FUSION (Q50092864)
- BRAF G496A (Q50092865)
- BRAF intron 9 rearrangement (Q50092874)
- BRAF intron 10 rearrangement (Q50092876)
- BCL2 Mutation (Q50092885)
- RASA1 LOSS-OF-FUNCTION (Q50887761)
- EGFR L861 (Q56240933)
- VHL R69fs (c.204insG) (Q56240947)
- VHL G144fs (c.432insG) (Q56240948)
- DICER1 D1709N (Q56240966)
- BTK MUTATION (Q56240979)
- PLCG2 MUTATION (Q56240980)
- DICER1 D1709G (Q56240983)
- DICER1 D1709E (Q56240984)
- FGFR2 FGFR2 mutations (Q56240986)
- BAP1 ALTERNATIVE TRANSCRIPT (ATI) (Q56240987)
- ASS1 LOSS (Q56240990)
- TLK2 AMPLIFICATION (Q56240992)
- VHL A56_P59del (c.166_178del) (Q56240994)
- NRG1 Fusion (Q56240996)
- NTRK1 TMP3-NTRK1 (Q56240998)
- VHL G144E (c.431G>A) (Q56241001)
- VHL Splicing alteration (c.463+8C>T) (Q56241002)
- EGFR Rare Mutation (Q56241007)
- PIK3CA EXON 20 MUTATION (Q56241010)
- PIK3CA EXON 9 MUTATION (Q56241012)
- AKT1 Overexpression (Q56241018)
- BRAF V600E/K and Amplification (Q56241020)
- PIK3R2 OVEREXPRESSION (Q56241021)
- VHL 3p26.3-25.3 11Mb del (Q56241025)
- VHL c.208G > A (Q56241026)
- VHL c.233 A>G (Q56241027)
- ABL1 TKD MUTATION (Q56241029)
- VHL c.128-?_250+? (Q56241030)
- ABL1 P-Loop Mutation (Q56241031)
- ABL1 Non-P-Loop Mutation (Q56241032)
- CALR Mutation (Q56241034)
- BRAF D594K (Q56241039)
- NTRK3 ETV6-NTRK3 FUSION (Q56241042)
- PRKCB D427N (Q56615783)
- VHL Exon 2 Deletion (Q59820119)
- VHL EXON 2-3 DELETION (Q59820120)
- VHL Splicing alteration (c.463+2T>C) (Q59820243)
- VHL V66Gfs*89 (c.197_209del) (Q59820249)
- VHL R79_S80del (c.236_241delGCAGTC) (Q59820250)
- VHL G114Vfs*45 (c.339delA) (Q59820255)
- VHL Splice Site (c.464-2G>A) (Q59820258)
- JAK2 F694L (Q60243481)
- VHL N131T (c.392A>C) (Q60934761)
- VHL Null (Complete deletion) (Q61818918)
- VHL Rearrangement (Q61818930)
- ABL1 FOXP1-ABL1 (Q63986124)
- PDGFRA D842_H845DELDIMH (Q66084442)
- HRAS Q61 (Q66084570)
- KIT T417_D419delinsY (Q66084575)
- KIT F506_F508DUP (Q66084576)
- KIT K484_G487DEL (Q66084577)
- PDGFRA Exon 18 Mutation (Q66084578)
- KIT Exon 13 Mutation (Q66084579)
- BRAF Exon 15 Mutation (Q66084580)
- KIT V555_V559DEL (Q66084585)
- KIT K550_K559DEL (Q66084586)
- CDKN2A Mutation (Q66084587)
- MET R1004G (Q72011747)
- FGF19 EXPRESSION (Q72011862)
- NFE2L2 MUTATION (Q74011867)
- H3-3B K36M (Q76176922)
- H3-3A G34W (Q76176939)
- BRAF N486_P490del (Q76177655)
- ABL2 Fusion (Q79419373)
- PARP1 OVEREXPRESSION (Q79419402)
- PDGFB EBF1-PDGFRB (Q79419452)
- ABL1 ABL1-RCSD (Q79419469)
- IKZF1 IKZF1 deletion (Q79419489)
- FGFR3 Mutations (Q79419509)
- NT5C2 Mutation (Q83482789)
- H3-3A MUTATION (Q86216993)
- ATRX DELETION (Q86217001)
- CDKN2A Deletion (Q86217006)
- MYB AMPLIFICATION (Q86217009)
- IKZF1 IKZF1 deletion and mutation (Q86217213)
- NT5C2 R238W (Q86217552)
- IL6 Overexpression (Q86217644)
- PRPS1 PRPS1 MUTATION (Q86217682)
- PRPS1 L191F (Q86217709)
- PRPS1 A190T (Q86217724)
- H3-3A K27M (Q88411882)
- FGFR1 Internal Duplication (Q88412210)
- BRAF V600_K601>E (Q88412404)
- BRAF G469 (Q88412410)
- VHL 106insR (c.316insGCC) (Q88412517)
- VHL 77insL(c.230insTCT) (Q88412521)
- CHEK2 R474C c.1420C>T (Q88412557)
- KRAS A146 (Q88412581)
- VHL c.−213− ?_463 ?del (Q92590511)
- VHL c.341-59_341-14del (Q92590528)
- PRPS1 T303S (Q92591602)
- PRPS1 D183E (Q92591633)
- PRPS1 K176N (Q92591639)
- PRPS1 N144S (Q92591664)
- PRPS1 S103I (Q92591677)
- PRPS1 S103N (Q92591684)
- PRPS1 S103T (Q92591690)
- PRPS1 D139G (Q92591728)
- PRPS1 C77S (Q92591734)
- PRPS1 I72V (Q92591743)
- PRPS1 V53A (Q92591749)
- PRPS1 A87T (Q92591757)
- PRPS1 M115T (Q92591765)
- ABL1 Double Ph (Q92591933)
- PIK3CA Exon 10 and Exon 21 Mutation (Q96007037)
- CTNNB1 exon 3 mutations (Q96008265)
- PDGFRA Overexpression (Q96008277)
- PDGFRB Overexpression (Q96008315)
- CDK6 EXPRESSION (Q96008384)
- ATM c.902-1G>T (Q96008397)
- ATM c.7089+1del (Q96008404)
- ATM c.7515+1_2del (Q96008412)
- FLT3 D835Y (Q96649458)
- VHL R177ins (c.531insCTGAGAGTAAAGCCTGAA) (Q97619984)
- VHL L178P (c.532C>T) (Q97620064)
- FLT3 D835I (Q97620216)
- SMARCA4 LOSS (Q98713507)
- BRCA2 K3326* (Q98713516)
- FLT3 Y842C (Q98713568)
- FLT3 F691L (Q99542856)
- ATRX Mutation (Q99542859)
- PIK3CA Rare Mutation (Q102214202)
- CTNNB1 Exon 3 Mutation (Q104539495)
- SMARCB1 LOSS (Q104539535)
- VHL Null (Large deletion) (Q105026760)
- VHL F76del (c.227_229del) (Q105027138)
- VHL C77fs (c.230del) (Q105027161)
- EGFR M766_A767insASV (Q105669004)
- EGFR D770delinsGY (Q105669006)
- LYN OVEREXPRESSION (Q105669095)
- AKT1 S473 Phosphorylation (Q105669122)
- VHL D121_A122del (c.361_366del) (Q106942679)
- CDKN1A rs1801270 (Q106942696)
- FGF19 Overexpression (Q106942707)
- SMAD4 R361C (Q106942713)
- NF2 c.1396C>T (Q106942740)
- NTRK1 LMNA::NTRK1 e2-e10 (Q106942743)
- PDGFRA Mutation (Q106942752)
- PPP2R1A P179R (Q106942754)
- PIK3CA Exon 10 or Exon 21 Mutation (Q106942755)
- CDKN1A rs1059234 (Q106942756)
- TP53 P250L (Q106942757)
- EZH2 Y641S (Q107521951)
- VHL Deletion (Q107521991)
- KRAS G10_A11insG (Q107522014)
- KRAS A11_G12insGA (Q107522015)
- KDR R1032Q (Q107522017)
- EZH2 Y646H (Q107522019)
- ALK I1171T (Q107522020)
- CD44 CD44v6 (Q107522022)
- PIK3R2 G373R (Q107522024)
- PTEN C136R (Q107522025)
- EZH2 Y641F (Q107522027)
- EZH2 Y641N (Q107522028)
- EZH2 Y641H (Q107522029)
- BRAF G463E (Q107522030)
- TP53 R342P (Q109676754)
- TP53 L330P (Q109676755)
- TP53 L330R (Q109676756)
- TP53 R337P (Q109676758)
- TP53 L344P (Q109676759)
- PIM1 L2V (Q110243523)
- PIM1 P81S (Q110243524)
- PIM1 S97N (Q110243525)
- ACVR1 MUTATION (Q110650112)
- NFE2L2 G31A (Q110650611)
- ACVR1 R206H (Q110650758)
- ACVR1 G356D (Q110650775)
- EZH2 Y646C (Q111015481)
- FLCN c.1285dupC (Q111015485)
- SLC29A1 Overexpression (Q111015486)
- EZH2 Activating Mutation (Q111015488)
- ERBB2 Exon 20 Insertion (Q111398991)
- IGF1R Overexpression (Q111399004)
- TP53 T125T (Q111399013)
- CTCF K365T (Q111399014)
- SSTR5 expression (Q111399015)
- TP53 E286K (Q111691869)
- TP53 S241F (Q111692176)
- TP53 D259V (Q111692245)
- TP53 P98S (Q111692260)
- TP53 P98L (Q111692261)
- TP53 Y126D (Q111692262)
- TP53 Y126S (Q111692263)
- TP53 K139E (Q111692264)
- TP53 P151S (Q111692265)
- PIK3CA H1047L or H1047R (Q111692267)
- TP53 P152L (Q111692268)
- TP53 I162F (Q111692270)
- TP53 Y163H (Q111692271)
- TP53 Y236S (Q111692272)
- TP53 L252F (Q111692273)
- TP53 E258K (Q111692274)
- TP53 G262D (Q111692276)
- TP53 G266E (Q111692277)
- TP53 L308M (Q111692278)
- TP53 L323P (Q111692279)
- TP53 Q144P (Q111692280)
- TP53 P219H (Q111692281)
- TP53 Y220H (Q111692283)
- TP53 E224K (Q111692284)
- TP53 Y234H (Q111692286)
- TP53 T230S (Q111692287)
- TP53 H168Y (Q111692289)
- TP53 P177S (Q111692290)
- TP53 P177F (Q111692291)
- TP53 P177H (Q111692292)
- TP53 N239S (Q111692293)
- TP53 S241T (Q111692294)
- TP53 M246L (Q111692295)
- TP53 P152T (Q111692296)
- TP53 R156P (Q111692297)
- TP53 R181C (Q111692298)
- TP53 R181G (Q111692299)
- TP53 R181H (Q111692300)
- TP53 R283H (Q111692302)
- TP53 Y163N (Q111692303)
- TP53 L257P (Q111692304)
"Entity types" violations
[edit]Violations count: 0
"Scope" violations
[edit]Violations count: 0
"Type sequence variant (Q15304597)" violations
[edit]Violations count: 423
- ERBB2 Amplification (Q27908387): Transcript Amplification (Q27907091)
- TP53 DNA Binding Domain Mutation (Q28371205): DNA binding site (Q5205743)
- EGFR VIII (Q28371264): disruptive inframe deletion (Q42866969)
- GADD45A rs681673 (Q28371621): Coding Transcript Intron Variant (Q28419134)
- BRCA2 TRUNCATING MUTATION (Q28371625): feature truncation (Q42805784)
- UGT1A1 UGT1A1*60 (Q28371647): microsatellite (Q265193)
- EGFR V769_770insASV (Q28371649): Insertion (Q32937968)
- DPYD DPYD*2A HOMOZYGOSITY (Q28371650): Splice Donor Variant (Q29937349)
- ERBB2 M774DELINSWLV (Q28371692): inframe indel (Q42866966)
- NPM1 W288FS (Q28381458): Frameshift Elongation (Q28381989)
- FLT3 TKD MUTATION (Q28381821): Nonsynonymous Variant (Q27905684)
- NOTCH1 S2275FS (Q28381849): Plus 1 Frameshift Variant (Q28381736)
- EGFR Copy Number Variation (Q28382120): Copy Number Change (Q28381984)
- IKZF1 DELETION (Q28382133): Transcript Ablation (Q28381986)
- TERT Promoter Mutation (Q28382152): Regulatory Region Variant (Q28381988)
- NF2 Y177fs (Q28382165): Frameshift Elongation (Q28381989)
- TERT C228T (Q28382166): Regulatory Region Variant (Q28381988)
- FNTB RS11623866 (Q28382220): Regulatory Region Variant (Q28381988)
- KRAS RS61764370 (Q28420832): 3 Prime UTR Variant (Q28419124)
- ABCB1 I1145I (Q28421333): Synonymous Variant (Q28419125)
- TYMS 5' TANDEM REPEAT (Q28421466): 5 Prime UTR Variant (Q27919343), Short Tandem Repeat Variation (Q28419126)
- MGMT RS16906252 (Q28422524): Synonymous Variant (Q28419125)
- ETS2 RS461155 (Q28423012): Synonymous Variant (Q28419125)
- KIT RS3733542 (Q28423248): Synonymous Variant (Q28419125)
- HSPH1 T17 DELETION (Q28423257): Short Tandem Repeat Variation (Q28419126)
- MDM2 SNP309 (Q28423261): Coding Transcript Intron Variant (Q28419134)
- PMS2 K706FS*19 (Q28423265): Minus 1 Frameshift Variant (Q28419135)
- CDKN2A RS3814960 (Q28423327): 5 Prime UTR Exon Variant (Q28419138)
- MDM2 RS34886328 (Q28423328): 3 Prime UTR Truncation (Q28419139)
- UGT1A1 UGT1A1*28 (Q28423367): microsatellite (Q265193)
- TP53 Wildtype (Q28439291): wild type (Q128723)
- CCND1 Amplification (Q28444926): Transcript Amplification (Q27907091)
- FOXP1 AMPLIFICATION (Q28444941): Transcript Amplification (Q27907091)
- REL AMPLIFICATION (Q28444942): Transcript Amplification (Q27907091)
- AURKA AMPLIFICATION (Q28444955): Transcript Amplification (Q27907091)
- CCNE1 Amplification (Q28444962): Transcript Amplification (Q27907091)
- EGFR Amplification (Q28444964): Transcript Amplification (Q27907091)
- NCOA3 AMPLIFICATION (Q28444969): Transcript Amplification (Q27907091)
- PIK3CA Amplification (Q28444974): Transcript Amplification (Q27907091)
- PTEN Deletion (Q28444975): Transcript Ablation (Q28381986)
- TERT Amplification (Q28444980): Transcript Amplification (Q27907091)
- TTF1 AMPLIFICATION (Q28444984): Transcript Amplification (Q27907091)
- GSTP1 DELETION (Q28444988): Transcript Ablation (Q28381986)
- BIRC7 AMPLIFICATION (Q28444989): Transcript Amplification (Q27907091)
- FGFR1 Amplification (Q28444992): Transcript Amplification (Q27907091)
- MET Amplification (Q28444994): Transcript Amplification (Q27907091)
- MYCN Amplification (Q28445010): Transcript Amplification (Q27907091)
- MAPK1 AMPLIFICATION (Q28445026): Transcript Amplification (Q27907091)
- NOTCH1 AMPLIFICATION (Q28445033): Transcript Amplification (Q27907091)
- RSF1 AMPLIFICATION (Q28445054): Transcript Amplification (Q27907091)
- TOP1 AMPLIFICATION (Q28445062): Transcript Amplification (Q27907091)
- TYMS Amplification (Q28445070): Transcript Amplification (Q27907091)
- ABCC3 AMPLIFICATION (Q28445094): Transcript Amplification (Q27907091)
- ASNS AMPLIFICATION (Q28445096): Transcript Amplification (Q27907091)
- CDK4 AMPLIFICATION (Q28445152): Transcript Amplification (Q27907091)
- CDKN2B LOSS (Q28445154): Transcript Ablation (Q28381986)
- RICTOR AMPLIFICATION (Q28445159): Transcript Amplification (Q27907091)
- KIT Amplification (Q28445161): Transcript Amplification (Q27907091)
- RAF1 AMPLIFICATION (Q28445164): Transcript Amplification (Q27907091)
- KRAS Amplification (Q28445165): Transcript Amplification (Q27907091)
- FGFR2 Amplification (Q28445180): Transcript Amplification (Q27907091)
- FGF3 AMPLIFICATION (Q28445181): Transcript Amplification (Q27907091)
- AKT2 Amplification (Q28445184): Transcript Amplification (Q27907091)
- SMAD4 Deletion (Q28445190): Transcript Ablation (Q28381986)
- LRP1B DELETION (Q28445191): Transcript Ablation (Q28381986)
- CDH1 MUTATION (Q28445202): Transcription Variant (Q28419121)
- SMARCB1 DELETION (Q28445214): Transcript Ablation (Q28381986)
- PDGFRA Amplification (Q28445223): Transcript Amplification (Q27907091)
- KIT rs17084733 (Q28531492): 3 Prime UTR Variant (Q28419124)
- BRAF WILD TYPE (Q28531503): wild type (Q128723)
- MLH1 c.790+1G>A (Q28599625): Splice Donor Variant (Q29937349)
- MLH1 *757L (Q28599636): Stop Lost (Q28419141)
- MSH2 E28FS (Q28599652): Frameshift Elongation (Q28381989)
- EPCAM 3' EXON DELETION (Q28735684): disruptive inframe deletion (Q42866969)
- VHL E55= (c.165G>A) (Q29937960): Synonymous Variant (Q28419125)
- VHL M1FS (c.1_17del17) (Q29938260): Start Lost (Q29938065)
- VHL M1? (c.1-1_20del21) (Q29938261): Start Lost (Q29938065)
- VHL M1? (c.3G>A) (Q29938264): Start Lost (Q29938065)
- GNAS c.393T>C (Q29938321): Synonymous Variant (Q28419125)
- TP53 R306X (Q29938372):
- TP53 R282W (Q29938373):
- TP53 C275Y (Q29938376):
- TP53 V272M (Q29938380):
- TP53 R248L (Q29938381):
- TP53 R248FS (Q29938383):
- TP53 R213X (Q29938386):
- TP53 V272L (Q29938529):
- TP53 G245D (Q29938530):
- TP53 R342X (Q29938531):
- TP53 E298X (Q29938533):
- TP53 E286V (Q29938534):
- TP53 E285K (Q29938535):
- TP53 D281E (Q29938536):
- TP53 D281G (Q29938537):
- TP53 D281H (Q29938539):
- TP53 R280S (Q29938541):
- TP53 R280I (Q29938543):
- TP53 C275G (Q29938546):
- TP53 R273G (Q29938547):
- TP53 F270S (Q29938548):
- TP53 R267P (Q29938552):
- TP53 G266R (Q29938553):
- TP53 D259Y (Q29938554):
- TP53 I255S (Q29938556):
- TP53 T253P (Q29938557):
- TP53 G245V (Q29938559):
- TP53 G244S (Q29938563):
- TP53 M243V (Q29938564):
- TP53 C242S (Q29938566):
- TP53 S241C (Q29938569):
- TP53 Y234S (Q29938575):
- TP53 V216L (Q29938576):
- TP53 V203L (Q29938583):
- TP53 L201F (Q29938585):
- TP53 R196X (Q29938589):
- TP53 I195N (Q29938592):
- TP53 L194P (Q29938593):
- TP53 H193R (Q29938594):
- TP53 P190L (Q29938596):
- TP53 H179Q (Q29938598):
- TP53 H179R (Q29938600):
- TP53 H179Y (Q29938601):
- TP53 H179D (Q29938602):
- TP53 R174W (Q29938606):
- TP53 V173L (Q29938607):
- TP53 Y163C (Q29938608):
- TP53 M160K (Q29938611):
- TP53 R158P (Q29938617):
- TP53 P151H (Q29938622):
- TP53 C141W (Q29938623):
- TP53 K132R (Q29938626):
- TP53 K132T (Q29938628):
- TP53 K132E (Q29938630):
- TP53 K132Q (Q29938631):
- TP53 L130V (Q29938632):
- TP53 Y103X (Q29938635):
- TP53 V73L (Q29938638):
- TP53 D42Y (Q29938640):
- BRAF Amplification (Q29938769): Transcript Amplification (Q27907091)
- NTRK1 Amplification (Q29938785): Transcript Amplification (Q27907091)
- NTRK3 Amplification (Q29938787): Transcript Amplification (Q27907091)
- ABL1 C475V (Q32965441): Splice Donor Variant (Q29937349)
- JAK2 Splice Site (c.1641+2T>G) (Q32965598): Splice Donor Variant (Q29937349)
- VHL V62fs (c.180del) (Q32965748): Minus 1 Frameshift Variant (Q28419135)
- VHL L101G (c.301_302delinsGG) (Q32966039): Indel (Q32949508)
- VHL L118fs (c.352_353insA) (Q32966048): Plus 1 Frameshift Variant (Q28381736)
- VHL S111C (c.330_331delinsTT) (Q32966087): Indel (Q32949508)
- VHL Q132P (c.395A>C) (Q42786636):
- VHL F91* (c.272_273delinsAA) (Q42786647):
- VHL V170G (c.509T>C) (Q42786663):
- VHL Exon 3 Deletion (Q42786682):
- VHL T105fs (c.315insAC) (Q42786690):
- VHL P71fs (c.211insT) (Q42786691):
- VHL L140fs (c.417_418delTC) (Q42786697):
- VHL M54fs (c.161insT) (Q42786699):
- VHL P154= (c.462A>C) (Q42786701): Synonymous Variant (Q28419125)
- VHL *214L (c.641G>T) (Q42786716): Stop Lost (Q28419141)
- VHL *214W (c.642A>G) (Q42786717): Stop Lost (Q28419141)
- VHL Splicing alteration (c.463+2C>T) (Q42786721):
- VHL Splice Site (c.463+1G>C) (Q42786729): Splice Donor Variant (Q29937349)
- VHL P61fs (c.183insC) (Q42786738):
- VHL R108ins (c.324InsCGC) (Q42786745):
- VHL A149fs (c.449del14-nt) (Q42786748):
- VHL 3'UTR alteration (c.639+10C>G) (Q42786750): 3 Prime UTR Variant (Q28419124)
- VHL Null (Partial deletion of Exons 2 & 3) (Q42786760):
- VHL T152fs (c.455insA) (Q42786785):
- VHL G114dup (c.342dupGGT) (Q42786806):
- VHL Q73fs (c.214insGCCC) (Q42786810):
- VHL C77fs (c.228dup) (Q42786813):
- VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT) (Q42786816):
- VHL H125fs (c.374insA) (Q42786818):
- VHL T202fs (c.606insA) (Q42786827):
- VHL A56fs (c.166dup) (Q42786830): Plus 1 Frameshift Variant (Q28381736)
- VHL R161= (c.481C>A) (Q42786833): Synonymous Variant (Q28419125)
- VHL 3'UTR alteration (c.*70C>A) (Q42786838): 3 Prime UTR Variant (Q28419124)
- VHL Splice Site (c.464-1G>A) (Q42868285): splice acceptor variant (Q42866965)
- VHL Splice Site (c.464-2A>T) (Q42868293): splice acceptor variant (Q42866965)
- VHL Splice Site (c.464-1G>C) (Q42868323): splice acceptor variant (Q42866965)
- VHL Splice Site (c.464-2A>G) (Q42868324): splice acceptor variant (Q42866965)
- VHL Splice Site (c.341-2A>C) (Q42868341): splice acceptor variant (Q42866965)
- RAD50 L1237F (Q44844631):
- ERRFI1 E384Ter (Q44844639):
- EGFR V834I (Q44847119):
- ACVR1 Gain-of-Function (Q44847200):
- VHL Splice Site (c.464-1G>T) (Q50092729): splice acceptor variant (Q42866965)
- VHL P40fs (c.118ins) (Q50092790):
- VHL T157fs (c.472ins) (Q50092792):
- BARD1 LOSS-OF-FUNCTION (Q50092860):
- ALK ALK FUSION (Q50092864):
- BRAF G496A (Q50092865):
- BRAF intron 9 rearrangement (Q50092874):
- BRAF intron 10 rearrangement (Q50092876):
- BCL2 Mutation (Q50092885):
- RASA1 LOSS-OF-FUNCTION (Q50887761):
- EGFR L861 (Q56240933):
- VHL R69fs (c.204insG) (Q56240947):
- VHL G144fs (c.432insG) (Q56240948):
- VHL *214C (c.642A>T) (Q56240949): Stop Lost (Q28419141)
- DICER1 D1709N (Q56240966):
- VHL Splice Site (c.340+1G>A) (Q56240972): Splice Donor Variant (Q29937349)
- BTK MUTATION (Q56240979):
- PLCG2 MUTATION (Q56240980):
- DICER1 D1709G (Q56240983):
- DICER1 D1709E (Q56240984):
- FGFR2 FGFR2 mutations (Q56240986):
- BAP1 ALTERNATIVE TRANSCRIPT (ATI) (Q56240987):
- ASS1 LOSS (Q56240990):
- TLK2 AMPLIFICATION (Q56240992):
- VHL A56_P59del (c.166_178del) (Q56240994):
- NRG1 Fusion (Q56240996):
- NTRK1 TMP3-NTRK1 (Q56240998):
- VHL G144E (c.431G>A) (Q56241001):
- VHL Splicing alteration (c.463+8C>T) (Q56241002):
- EGFR Rare Mutation (Q56241007):
- PIK3CA EXON 20 MUTATION (Q56241010):
- PIK3CA EXON 9 MUTATION (Q56241012):
- AKT1 Overexpression (Q56241018):
- BRAF V600E/K and Amplification (Q56241020):
- PIK3R2 OVEREXPRESSION (Q56241021):
- VHL 3p26.3-25.3 11Mb del (Q56241025):
- VHL c.208G > A (Q56241026):
- VHL c.233 A>G (Q56241027):
- ABL1 TKD MUTATION (Q56241029):
- VHL c.128-?_250+? (Q56241030):
- ABL1 P-Loop Mutation (Q56241031):
- ABL1 Non-P-Loop Mutation (Q56241032):
- CALR Mutation (Q56241034):
- BRAF D594K (Q56241039):
- NTRK3 ETV6-NTRK3 FUSION (Q56241042):
- PRKCB D427N (Q56615783):
- VHL *214G (c.640T>G) (Q56615791): Stop Lost (Q28419141)
- VHL Exon 2 Deletion (Q59820119):
- VHL EXON 2-3 DELETION (Q59820120):
- VHL Splicing alteration (c.463+2T>C) (Q59820243):
- VHL V66Gfs*89 (c.197_209del) (Q59820249):
- VHL R79_S80del (c.236_241delGCAGTC) (Q59820250):
- VHL G114Vfs*45 (c.339delA) (Q59820255):
- VHL Splice Site (c.464-2G>A) (Q59820258):
- JAK2 F694L (Q60243481):
- VHL N131T (c.392A>C) (Q60934761):
- PIK3CA Wildtype (Q60934773): wild type (Q128723)
- VHL Null (Complete deletion) (Q61818918):
- VHL Rearrangement (Q61818930):
- ABL1 FOXP1-ABL1 (Q63986124):
- PDGFRA D842_H845DELDIMH (Q66084442):
- HRAS Q61 (Q66084570):
- KIT T417_D419delinsY (Q66084575):
- KIT F506_F508DUP (Q66084576):
- KIT K484_G487DEL (Q66084577):
- PDGFRA Exon 18 Mutation (Q66084578):
- KIT Exon 13 Mutation (Q66084579):
- BRAF Exon 15 Mutation (Q66084580):
- KIT WILDTYPE (Q66084581): wild type (Q128723)
- KIT V555_V559DEL (Q66084585):
- KIT K550_K559DEL (Q66084586):
- CDKN2A Mutation (Q66084587):
- MET R1004G (Q72011747):
- FGF19 EXPRESSION (Q72011862):
- NFE2L2 MUTATION (Q74011867):
- H3-3B K36M (Q76176922):
- H3-3A G34W (Q76176939):
- BRAF N486_P490del (Q76177655):
- EGFR Wildtype (Q79419097): wild type (Q128723)
- ABL2 Fusion (Q79419373):
- PARP1 OVEREXPRESSION (Q79419402):
- PDGFB EBF1-PDGFRB (Q79419452):
- ABL1 ABL1-RCSD (Q79419469):
- IKZF1 IKZF1 deletion (Q79419489):
- FGFR3 Mutations (Q79419509):
- NT5C2 Mutation (Q83482789):
- H3-3A MUTATION (Q86216993):
- ATRX DELETION (Q86217001):
- CDKN2A Deletion (Q86217006):
- MYB AMPLIFICATION (Q86217009):
- IKZF1 IKZF1 deletion and mutation (Q86217213):
- NT5C2 R238W (Q86217552):
- IL6 Overexpression (Q86217644):
- PRPS1 PRPS1 MUTATION (Q86217682):
- PRPS1 L191F (Q86217709):
- PRPS1 A190T (Q86217724):
- H3-3A K27M (Q88411882):
- FGFR1 Internal Duplication (Q88412210):
- BRAF V600_K601>E (Q88412404):
- BRAF G469 (Q88412410):
- VHL 106insR (c.316insGCC) (Q88412517):
- VHL 77insL(c.230insTCT) (Q88412521):
- CHEK2 R474C c.1420C>T (Q88412557):
- KRAS A146 (Q88412581):
- VHL c.−213− ?_463 ?del (Q92590511):
- VHL c.341-59_341-14del (Q92590528):
- VHL *214C (c.641_642insC) (Q92590632): Stop Lost (Q28419141)
- PRPS1 T303S (Q92591602):
- PRPS1 D183E (Q92591633):
- PRPS1 K176N (Q92591639):
- PRPS1 N144S (Q92591664):
- PRPS1 S103I (Q92591677):
- PRPS1 S103N (Q92591684):
- PRPS1 S103T (Q92591690):
- PRPS1 D139G (Q92591728):
- PRPS1 C77S (Q92591734):
- PRPS1 I72V (Q92591743):
- PRPS1 V53A (Q92591749):
- PRPS1 A87T (Q92591757):
- PRPS1 M115T (Q92591765):
- ABL1 Double Ph (Q92591933):
- PIK3CA Exon 10 and Exon 21 Mutation (Q96007037):
- CTNNB1 exon 3 mutations (Q96008265):
- PDGFRA Overexpression (Q96008277):
- PDGFRB Overexpression (Q96008315):
- CDK6 EXPRESSION (Q96008384):
- ATM c.902-1G>T (Q96008397):
- ATM c.7089+1del (Q96008404):
- ATM c.7515+1_2del (Q96008412):
- FLT3 D835Y (Q96649458):
- VHL R177ins (c.531insCTGAGAGTAAAGCCTGAA) (Q97619984):
- VHL L178P (c.532C>T) (Q97620064):
- FLT3 D835I (Q97620216):
- SMARCA4 LOSS (Q98713507):
- BRCA2 K3326* (Q98713516):
- FLT3 Y842C (Q98713568):
- FLT3 F691L (Q99542856):
- KRAS Wildtype (Q99542858): wild type (Q128723)
- ATRX Mutation (Q99542859):
- PIK3CA Rare Mutation (Q102214202):
- CTNNB1 Exon 3 Mutation (Q104539495):
- SMARCB1 LOSS (Q104539535):
- VHL Null (Large deletion) (Q105026760):
- VHL F76del (c.227_229del) (Q105027138):
- VHL C77fs (c.230del) (Q105027161):
- VHL Q96_P97delinsH (c.288_290del) (Q105027162): disruptive inframe deletion (Q42866969)
- VHL Splice Site (c.463+2T>C) (Q105668976): Splice Donor Variant (Q29937349)
- EGFR M766_A767insASV (Q105669004):
- EGFR D770delinsGY (Q105669006):
- LYN OVEREXPRESSION (Q105669095):
- AKT1 S473 Phosphorylation (Q105669122):
- VHL G104= (c.312C>G) (Q106942654): Synonymous Variant (Q28419125)
- VHL D121_A122del (c.361_366del) (Q106942679):
- CDKN1A rs1801270 (Q106942696):
- FGF19 Overexpression (Q106942707):
- SMAD4 R361C (Q106942713):
- NF2 c.1396C>T (Q106942740):
- NTRK1 LMNA::NTRK1 e2-e10 (Q106942743):
- PDGFRA Mutation (Q106942752):
- PPP2R1A P179R (Q106942754):
- PIK3CA Exon 10 or Exon 21 Mutation (Q106942755):
- CDKN1A rs1059234 (Q106942756):
- TP53 P250L (Q106942757):
- EZH2 Y641S (Q107521951):
- VHL Deletion (Q107521991):
- KRAS G10_A11insG (Q107522014):
- KRAS A11_G12insGA (Q107522015):
- KDR R1032Q (Q107522017):
- EZH2 Y646H (Q107522019):
- ALK I1171T (Q107522020):
- CD44 CD44v6 (Q107522022):
- PIK3R2 G373R (Q107522024):
- PTEN C136R (Q107522025):
- EZH2 Y641F (Q107522027):
- EZH2 Y641N (Q107522028):
- EZH2 Y641H (Q107522029):
- BRAF G463E (Q107522030):
- TP53 R342P (Q109676754):
- TP53 L330P (Q109676755):
- TP53 L330R (Q109676756):
- TP53 R337P (Q109676758):
- TP53 L344P (Q109676759):
- PIM1 L2V (Q110243523):
- PIM1 P81S (Q110243524):
- PIM1 S97N (Q110243525):
- ACVR1 MUTATION (Q110650112):
- NFE2L2 G31A (Q110650611):
- ACVR1 R206H (Q110650758):
- ACVR1 G356D (Q110650775):
- EZH2 Y646C (Q111015481):
- FLCN c.1285dupC (Q111015485):
- SLC29A1 Overexpression (Q111015486):
- EZH2 Activating Mutation (Q111015488):
- ERBB2 Exon 20 Insertion (Q111398991):
- IGF1R Overexpression (Q111399004):
- TP53 T125T (Q111399013):
- CTCF K365T (Q111399014):
- SSTR5 expression (Q111399015):
- TP53 E286K (Q111691869):
- TP53 S241F (Q111692176):
- TP53 D259V (Q111692245):
- TP53 P98S (Q111692260):
- TP53 P98L (Q111692261):
- TP53 Y126D (Q111692262):
- TP53 Y126S (Q111692263):
- TP53 K139E (Q111692264):
- TP53 P151S (Q111692265):
- PIK3CA H1047L or H1047R (Q111692267):
- TP53 P152L (Q111692268):
- TP53 I162F (Q111692270):
- TP53 Y163H (Q111692271):
- TP53 Y236S (Q111692272):
- TP53 L252F (Q111692273):
- TP53 E258K (Q111692274):
- TP53 G262D (Q111692276):
- TP53 G266E (Q111692277):
- TP53 L308M (Q111692278):
- TP53 L323P (Q111692279):
- TP53 Q144P (Q111692280):
- TP53 P219H (Q111692281):
- TP53 Y220H (Q111692283):
- TP53 E224K (Q111692284):
- TP53 Y234H (Q111692286):
- TP53 T230S (Q111692287):
- TP53 H168Y (Q111692289):
- TP53 P177S (Q111692290):
- TP53 P177F (Q111692291):
- TP53 P177H (Q111692292):
- TP53 N239S (Q111692293):
- TP53 S241T (Q111692294):
- TP53 M246L (Q111692295):
- TP53 P152T (Q111692296):
- TP53 R156P (Q111692297):
- TP53 R181C (Q111692298):
- TP53 R181G (Q111692299):
- TP53 R181H (Q111692300):
- TP53 R283H (Q111692302):
- TP53 Y163N (Q111692303):
- TP53 L257P (Q111692304):